arizona art bentley black blackwhitephotos blah blue bu canon chad clouds d90 dance dancer dancers dancing deli dolphins exp f35 film girl hair innit japanese light malta me monochrome nikon pagan performance photography popcorn portrait red redhead scribble selfportrait stage tag trees white yada zuiko

yada Flickr Hive Mind Users: gege.gatt Spkennedy3000 - Architectural Photographer Michelle.Blades. -Fearless- Sherri DuPree Bemis mister milz Chad Coombs EylulYaqmuru ertugrulincel KLnyc Pierre D. Zammit (more)  Preferences 
 Favorites   Groups   Interestingness   Recent   Tags   Text   User   Advanced 

I am a fan of Nicole Atkins's Music. Check her out!

-Nathan

 Recent   Interesting   Timeline 

Welcome to Flickr Hive Mind, almost certainly the best search engine for photography on the web. If you are a Flickr user and Log into Flickr you will be able to see your private photos, as well as larger thumbnails. Hivemind: http://flickrhivemind.net/Tags/yada Hits: 2890 Pages: 58 Flickr Hive Mind is a data mining tool for the Flickr photography database. Where do these thumbnails come from? How are the photos licensed?
you must solve the secret in my spirit-FP (NURAY YUZBASI) Tags: green turkey de happy dof purple bokeh gorgeous explore bud morningglory thursday frontpage ankara yada naturesfinest tomurcuk canonef100mmf28macrousm iekleri kahkaha sarmak platinumphoto colorphotoaward 100commentgroup vosplusbellesphotos hggt deniyor
 (-Fearless-) Tags: blue portrait selfportrait me girl self hair tshirt redhead views patterned yada strangeskirt imightjusttakethisdownbecauseimnotsurewhatithinkbutitcanthurttohaveitupforawhile mybrandnewthriftstoreskirt
I once was lost, but now (-Fearless-) Tags: blue portrait selfportrait me girl self hair tshirt redhead views patterned yada strangeskirt thriftstoreskirtmyfriendthoughtiwasinsaneforactuallybuying
Fame is the thirst of youth (gege.gatt) Tags: light shadow ballet monochrome youth point shadows dancing stage performance fame dancer musical balletshoes yada pointwork
#merryb (169 of 190) (rsp.) Tags: beach sunrise canon sigma australia merry 1020mm yada
Rocky outcrop on a hill that is Black (Spkennedy3000 - Architectural Photographer) Tags: hairy monster landscape big blah innit abergavenny monmouthshire yada llantony theblachhill simonkennedyphotography
Stormy Cyprus Vineyard (Spkennedy3000 - Architectural Photographer) Tags: bw white black clouds big vines stones cyprus grapes zuiko 18mm billowing f35 bathwater yada foreg4round
urfa2  EXP. 1 Mar.09 (~~klbk~~) Tags: foto ben o d az bi bu hdr biri ilk exp beni gzel yada suya denemem kald olmu fotoyu inallah ekerken fotografca uruna grouptripod canmdan beendim gidile decektim olacam dvecek olmutur
Dancing is like dreaming with your feet! (gege.gatt) Tags: lights star dance movement dancing grain performance dancer tights lingerie fishnets highiso yada graziella yadamalta
Seinfeld Quotes (Tom Trager) Tags: david nerd george tv cool funny graphic jerry quotes larry elaine cosmo festivus newman kramer vector costanza seinfeld vandelay yada
The truest expression of a people is in its dance and in its music.  Bodies never lie. (gege.gatt) Tags: art monochrome dance dancers dancing stage performance posture performers bodies yada contorsion
Anime Expo(AX) 2012 - Chun Li from "Street Fighter" (Hsin Tai Liu) Tags: california from street city summer portrait people urban 6 white black game anime art classic june 30 japanese li yahoo liu costume video los google search brawl flickr downtown comic fighter expo angeles cosplay wordpress arcade manga culture july 7 9 center pop southern tai event chun convention fighting tumble hsin bing 2012 capcom yada twitter 2013 stumblepon animeexpo2012 streetfightersutortofait commonlyabbreviatedassf isaseriesoffightinggamesdevelopedinjapaninwhichtheplayerspitthevideogamescompetitivefightersfromaroundtheworld eachwithhisorherownuniquefightingstyle againstoneanothersincecapcomreleasedthefirstarcadegameinaugust1987 theserieshashadtotalhomesoftwaresalesof33millionunits andarcadecabinetsalesofover500 000unitsgeneratingmorethan1billioninrevenue qualifyingforthelistofbestsellingvideogamefranchises withitsbestsellingentrystreetfighteriiexceeding15billioninrevenuethefranchisehasenjoyedsignificantsuccessallaroundtheworld
A private little hell (Peter Bellars) Tags: street sushi shinjuku child hell roach ricoh yada grd blackwhitephotos grd3 grdiii
reser sticker etc rtl dst (ECHO TANGO CHARLIE) Tags: lake ice axel suite ales gets bozo kost laker mech snak keen lep snafu spok yada dekor asic rukis edok qwit invitingallyouniggahsthatlikefightin
sx70 time zero Polaroid. (Chad Coombs) Tags: art film face analog hair square polaroid sx70 photography photo model time chad painted tag fine tags more photograph wig concept crow conceptual expired 70 doo zero yadayada sx coombs yada unscene unsceneart taggalot
514 (bulhaa) Tags: life blue sky black girl clouds standing weird purple wind air feel skirt step stop edge heels etc breathe maldives forward leggings yada uniquemaldives resultsofpms
YADA's Tribute to Michael Jackson (Pierre D. Zammit) Tags: canon fire dance dancing malta yada mfcc
.. ('sema) Tags: mat ya yada ta oyuncu oyun ahsn yadahasta
There is a bit of insanity in dancing that does everybody a great deal of good (gege.gatt) Tags: monochrome dance movement dancing body expression danza dancer 300mm expressive leotard yada canoneos5dmkii collegeofjazzdancemalta
Some oneI have met (Chad Coombs) Tags: camera portrait white black 120 film analog portraits chad series medium format concept conceptual yadda coombs yada yadddda cchadcoombs
332/365. Smiley Boy. (Anant N S (www.thelensor.tumblr.com)) Tags: yada smiley smily boy emoticon yellow macro filter photography diopter close up sticker pune india 1855 nikon d3000 anantns anant nath sharma lensor project365
iyi bayramlar... (ertugrulincel) Tags: anlamsz bir gibi bile sevgi gzel bar yada yere gn belkide u enteresan bayramlar bo olsa dnyada gnlerdir pekitii ylda kslerin bart barm yaptklar yapmamann varabilme gnleridir bayramgnleri dostluklarn zamanlardr dargnlklar farkndalna
uyu melek yzlm uyu..bu dnya dipsiz bir kuyu.. (DeryalN) Tags: deli yada zel blackwhitephotos uyurken yaparken srpriz tuygu superolmu delikzm uyuma numaras manyakderyaa
Wales stone pile longtown way (Spkennedy3000 - Architectural Photographer) Tags: rocky stuff welsh innit yada abigfave theunforgettablepictures fiveflickrfavs
Strolling through the Barbican Centre... (Spkennedy3000 - Architectural Photographer) Tags: man london love walking concrete centre arts barbican yada
Wales trekking with former marine (Spkennedy3000 - Architectural Photographer) Tags: wales marine near extreme royal blah orienteering zuiko abergavenny 18mm f35 yada blizzeard
Japanese Doll (Sherri DuPree Bemis) Tags: christmas trees toy japanese nikon doll rosebud blythe takara mrb yada d90 madamoiselle
yelken... (ertugrulincel) Tags: ngc ne her ama yola belli yol bir bodrum sonu olan yada yelken doarken aslnda olursa zaten kmak lazm gzeldir basmak yerlere mechule grebilene gzelliini varabilme varamamak balamyormu knda
Cypriot sunbeams (Spkennedy3000 - Architectural Photographer) Tags: camera light bw sun art dark lens cyprus awsome blah beams innit yada masterpice
 (Tonoz) Tags: canon beyaz iek yada falan filan macrolife auniverseofflowers awesomeblossoms yabansarmsa aysarmsa
bengalibazledimseni (eyruh) Tags: ama da bu yada yalnz gitti zledim birisi abisi kuzusu kaldm gtrd kuzularn sanrsam kat galba nereyegittiki hayallahbukardakisda yazikolmus
Leaves attempt to fly (SezzRS) Tags: turkey flying trkiye trkei istanbul exp yapraklar yada eypsultan notedited kular g9 canong9 leavesattendtofly anioldusabahgelipakamgittimyoksahabervermezmiyim leavesorbirds demekistabulageldinh
Japanese Doll (Sherri DuPree Bemis) Tags: christmas trees toy japanese nikon doll rosebud blythe takara mrb yada d90 madamoiselle
 (Michelle.Blades.) Tags: arizona film dolphins popcorn bentley pagan yada
Adults are always asking little kids what they want to be when they grow up because they're looking for ideas. (gege.gatt) Tags: art dance ballerina dancers dancing stage performance malta choreography mcc valletta yada
Bir Bahar Delisinin Mektuplar (EylulYaqmuru) Tags: deli p ya bahar yada olsun ederim tercih olmay 4mevsimbahar diyenlerdensen delisisin aksnp
Happy Halloween! (KLnyc) Tags: halloween happy fly ghost hell run around let loose yada
 (Michelle.Blades.) Tags: arizona film dolphins popcorn bentley pagan yada
connexions-doodle-2-DETAIL-1 (mister milz) Tags: blue red black lines pen ink drawing doodle scribble biro yada
Pinata Yada Yada Jelly Sandwich (RequiemArt.com) Tags: glitter rainbow natural nail touch polish mani sandwich nails dont jelly pinata manicure nailpolish tutu yada ulta
Mt Robson2 (G.GASP) Tags: trip sunset mountains clouds landscape jasper edmonton bc yada mtrobson
 (EylulYaqmuru) Tags: photography 50mm photo nikon fotograf bokeh yada birey ite bilmiyorum yle d5000 makinas fotorafmakinesi
IMG_0065small (yourealwaysbe) Tags: fish twins internet joker yada strobist
 ((mjh)) Tags: bicycle river kodak olympus 100uc nagoya 50mmf14 yada om4t
You don't stop dancing from growing old, you grow old from stopping to dance (gege.gatt) Tags: woman monochrome dance dancing stage performance malta mcc yada stagelighte
Motion (gege.gatt) Tags: motion sepia hair dance dancers stage hairflip dacing yada
Predator. (Jacob Holmn) Tags: tag videogame blahblahblah yada gt5 buticant polyphonydigital thisphotoisgreat crapcrapcrap fapfapfap granturismo5 greatcolours ithinkitsawesome yadayadayadayadayada stupidangles typicalingredientsofafjpic yesiindeedspamyourtaglistatthemoment clapclapclab okaynowireallywriteweirdthings ibetterstopnow iwanttotagthisthingmore tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag youcanreportmyasspammernow thanksinadvanceandgoodbye yadahasbeenprovidedbykirokai
connexions-doodle-2 (mister milz) Tags: blue red black lines pen ink drawing doodle scribble biro yada
 (Michelle.Blades.) Tags: arizona film dolphins popcorn bentley pagan yada


page:          1        2        3 
size:     -      

49 yada 7 dancing dance 6 black 5 performance art film stage blue 4 monochrome nikon hair portrait 3 dolphins innit dancer malta blah popcorn japanese white pagan girl photography bentley dancers clouds canon arizona trees light exp me selfportrait zuiko redhead bokeh bir photo takara blythe pen ink purple toy madamoiselle ya hell 18mm patterned big rosebud happy turkey varabilme movement camera analog coombs doll strangeskirt f35 bu chad d90 deli scribble red tag blackwhitephotos mrb tshirt conceptual street self concept lines landscape drawing abergavenny views biro ama christmas doodle cyprus güzel bw mcc ne stupidangles theunforgettablepictures buticant london mountains anioldusabahgelipakşamgittimyoksahabervermezmiyim rocky life emoticon morningglory glitter withitsbestsellingentrystreetfighteriiexceeding15billioninrevenuethefranchisehasenjoyedsignificantsuccessallaroundtheworld roach sonu uniquemaldives axel wind tai yadamalta g9 marine qwit özel wordpress qualifyingforthelistofbestsellingvideogamefranchises photograph man lights barışmış canonef100mmf28macrousm ederim model demekistabulageldinhıı july urban platinumphoto snafu uğruna explore ngc pune kaldım dark 1020mm küslerin cool nerd smiley capcom bi welsh sky convention zaten enteresan şahsın sürpriz yılda diyenlerdensen polaroid d5000 stumblepon danza granturismo5 götürdü yahoo grapes bile clapclapclab video inşallah yere olsun olacam costanza people southern california farkındalığına series canoneos5dmkii abisi leggings theserieshashadtotalhomesoftwaresalesof33millionunits billowing dövecek llantony fish anant yalnız yadahasbeenprovidedbykirokai anlamsız lazım mani step 50mm hsin 120 animeexpo2012 event şu kramer isaseriesoffightinggamesdevelopedinjapaninwhichtheplayerspitthevideogamescompetitivefightersfromaroundtheworld de blahblahblah anantns grd3 bahar manga heels up greatcolours sx bodies tumble musical mechule zamanlardır arts p larry format point los collegeofjazzdancemalta george günlerdir denemem fly da cosmo monmouthshire river expressive fine tutu thisphotoisgreat 2012 fighting newman sun foto commonlyabbreviatedassf beğendim yerlere düşecektim wig theblachhill özledim ghost extreme mfcc abigfave bicycle dont 1855 om4t game jasper wales gorgeous gün square bud etc asic sevgi olursa sunrise mybrandnewthriftstoreskirt nails işte summer yola vosplusbellesphotos bozo portraits olmayı edok nail iwanttotagthisthingmore standing run city gt5 başlamıyormu bc classic fame liu manicure bayramgünleri gibi hggt colorphotoaward flying türkiye suya loose 7 tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag green kost 2013 oyun yellow balletshoes lep anime delisisin lake naturesfinest 300mm diopter d3000 suite face

Pairs: 7 dance,yada 6 dance,dancing dancing,yada 4 blue,yada monochrome,yada dance,stage dancing,performance dancing,monochrome dance,performance stage,yada 3 bentley,popcorn

Users: gege.gatt 7 Spkennedy3000 - Architectural Photographer 6 Michelle.Blades. 3 -Fearless- Sherri DuPree Bemis mister milz Chad Coombs EylulYaqmuru ertugrulincel KLnyc Pierre D. Zammit rsp. G.GASP (mjh) Tom Trager SezzRS eyruh 'sema Peter Bellars Tonoz DeryalçıN RequiemArt.com ECHO TANGO CHARLIE bulhaa ~~kélébék~~ NURAY YUZBASI Anant N S (www.thelensor.tumblr.com) yourealwaysbe Jacob Holmén Hsin Tai Liu


Fiveprime.org supports The Mountain Institute - Sustaining mountain people, cultures and environments through education, conservancy, and sustainable development.